1. Introduction

ibrio cholerae is a natural inhabitant of the aquatic environment and this organism is introduced into human populations through the ingestion of contaminated food or water. In human after colonization to the small intestine through the action of a type IV pilus (TCP) it expresses cholera toxin (CT), which causes the electrolyte imbalance and profuse watery diarrhea. In natural aquatic environment Vibrio cholerae forms biofilm for its long survival in the environment and motility plays an important role in biofilm formation by inducing initial attachment to abiotic surface (Mois et al., Vibrio cholerae is a highly motile organism due to presence of a polar flagellum. Motility and virulence have been inferred to be inversely related to each other (Lospalluto and Finkelstein, 1972;Mekalanos et al., 1983;Taylor et al., 1987;Richardson, 1991). But the exact role of motility in pathogenesis is still remained unclear (Prouty et al., 2001).

The flagellum is a complex structure comprising of multiple structural subunits and expression of flagellar genes is also well regulated involving a four-tiered flagellar transcription hierarchy. Three regulatory genes, flrABC (express flagellar regulatory proteins ABC) are additionally required for the flagellar synthesis. FlrA encoded by class I gene is the master regulator of the flagellar transcriptional hierarchy and ? 54 -dependent transcriptional activator of class II genes, which encode mainly the MS ring and export apparatus components and regulatory factors, including FlrC (Millikan et al., 2003). FlrC is a ? 54 -dependent transcriptional activator that is phosphorylated by FlrB (sensor kinase) component and activates class III flagellar genes which encode the basal body and hook, as well as some of the switch and export apparatus components and the FlaA flagellin. Suggestion is there that the Vibrio cholerae polar flagellar filament is composed of five flagellins, but only one of these, FlaA is essential for motility (Klose and Mekalanos, 1998a).

Repression of FlrA and FlrC increase expression of EPS in response to some environmental signals (Watnic et al., 2001). On the other hand in Vibrio fishery FlrA / FlrC are also found to be involved in the motility (Millikan et al., 2003). In the epidemic subset of Vibrio cholerae including some O1 El Tor and O139 strain absence of flagellar structure triggers the expression of exopolysaccharie which is required for the development of the mature biofilm (Yildiz et al., 1999;Watnic et al., 2001). Beside this flaA (responsible for the synthesis of flagellar structural core protein) mutant strain is nonmotile as well as defective in intestinal colonization (Watnick et al., 2001).

Quorum sensing autoinducer molecules regulate the expression of EPS in Vibrio cholerae O139 Bengal strain MO10. The present study was conducted to investigate whether luxS gene (responsible for the synthesis of quorum sensing autoinducer molecule 2 i.e, AI-2) regulates motility as well as expression of both structural and functional regulatory genes flrA, flrB and flrC. In the peresent study we found that mutation in luxS gene caused reduction in motility and expression of flra was significantly decreased in the luxS mutant strain of the Vibrio cholerae O139 Bengal strain MO10 lac -. However expression of flrB and flrC remained unaltered by luxs gene. So luxS gene may regulate motility through the upregulation of flrA in Vibrio cholerae O139 Bengal strain MO10.

Keywords : Vibrio cholerae O139 Bengal strain MO10 lac-, Î?" luxS, Î?" flaAluxS, motility, Î?" -galactosidase assay.

2. Identification of the Role of LuxS in the Regulation of Motility & the Expression of the Flagellar Structural & Functional Regulators in

3. Vibrio Cholerae

It was previously proposed that cross-species quorum-sensing signaling molecule AI-2 (luxS gene product) stimulates biofilm formation and alters its architecture by stimulating flagellar motion and motility in Escherichia coli (González-Barrios et al., 2006). Moreover luxS gene was also reported to be involved in controlling chemotaxis, flagellar synthesis and motility in E. coli and Helicobactor pylori (Ren et

4. Methods and Materials

a) Bacterial growth MO10 luxS, flaAluxS mutant strain as well as Vibrio cholerae O139 Bengal strain MO10 lac -, a clinical isolate and a strain with high epidemiological importance were used for the present investigation.

Vibrio cholerae O139 Bengal strain MO10 lac -, luxS, flaAluxS were grown in Luria-Bertani (LB) broth, supplemented with streptomycin (100 µg of per ml). All the strains used for this study were displayed in the Vibrio cholerae MO10 lacwild type, Î?"luxS and Î?"flaAluxS strains were transformed with plasmids pSH130, pSH131 and pSH132 respectively, the transcriptional reporter constructs (Table 2). Bacterial cells grown in LB broth were harvested at OD 600 of ~ 0.2 to 0.4, permeabilized with chloroform and sodium dodecyl sulfate and assayed for ?-galactosidase activity following the method mentioned by Miller et al., 1992

5. Result and Discussion

In Vibrio cholerae flagellar synthesis and motility are thought to be important for cholera pathogenesis, but the exact role they play in virulence is still not completely understood. (Lospalluto and Finkelstein, 1972;Mekalanos et al., 1983;Taylor et al., 1987;Richardson et al., 1991;Prouty et al., 2001).

In many bacterial species, flagellar gene transcription occurs in a regulatory hierarchy in which the expression of late genes (i.e., class III or IV) is dependent on the expression of early ones (i.e., class I or II). In Vibrio cholerae, the ? 54 -dependent transcriptional activator FlrA is the sole class I gene which regulates the expression of FlrABC regulon (Prouty et al., 2001;Josenhans et al., 2002;Stewart et al., 1996). FlrA, FlrB and FlrC are reported to be additionally required for the expression of both flagellar structure and function in Vibrio cholerae. The flagellar motor regulates the exopolysaccharide expression. EPS expression was reported to be involved in biofilm formation and this in turn also affects the virulence of the organism because motility was required for its behavior of colonization (Klose & Mekalanos, 1998a). Report shows that repression of either FlrA-or FlrC-dependent transcription ceases flagellar synthesis and produces rugose colony in wild type Vibrio cholerae O139 (Watnic et al., 2001). Mutations in flagellar genes at any level results in the absence of a complete flagellar filament and also produce rugose colony morphology in the Vibrio cholerae O139 strain MO10 (Watnic et al., 2001).

Quorum sensing cell signaling molecule autoinducer 2 (luxS gene product) is also previously reported to control EPS expression, biofilm formation as well as motility in Helicobactor pylori as well as E. Coli (Ren et al., 2004;Osaki et al., 2006;Sperandio et al., 2001, Additionally it was also proposed that luxS gene (responsible for the synthesis of quorum-sensing signal AI-2) is involved in the regulation of EPS expression as well as biofilm formation in Vibrio cholerae O139 Bengal strain MO10 lac -(Biswas et al., 2012 unpublished). So, on the basis of this background we were interested to investigate the role of luxS (responsible for the synthesis of quorum sensing autoinducer molecule 2 i.e, AI-2) in motility as well as in the expression of both flagellar structural and functional regulatory genes i.e flrA, flrB and flrC. In our study we found that motility was reduced in the luxS mutant strain of Vibrio cholerae O139 Bengal strain MO10 lacthan that of the wild type (fig- 1). Beside this we also found that expression of flrA is significantly decreased after deletion in luxS gene in Vibrio cholerae

6. Conclusion

It can be concluded that luxS gene may regulate the motility through the upregulation of trancription of flrA in Vibrio cholerae O139 Bengal strain MO10 lacbut transcription of flrB and flrC were not influenced by luxS gene.

al., 2004; Sperandio et al., 2001; Osaki et al., 2006). It is also observed that luxS gene (responsible for the synthesis of quorum sensing cell signaling molecule autoinducer 2 i.e AI-2) regulates EPS expression and biofilm formation in Vibrio cholerae O139 Bengal strain MO10 lacthrough the Quorum sensing autoinducers and flagellum-dependent parallel but converging EPS signaling circuits independent of input of LuxO-HapR (Biswas et al., 2012, unpublished).However expression of flaA gene (responsible for the synthesis of flagellar structural core protein) was not under the control of luxS gene(Biswas et al., 2012, unpublished). So, on the basis of these reports the present study was carried out to investigate whether luxS gene (responsible for the synthesis of quorum sensing autoinducer molecule 2 i.e, AI-2) regulates motility as well as expressions of both structural and functional regulatory genes flrA, flrB and flrC.II. — Figure 1.

Fig. 2 : Comparison of flrA expression among luxS mutant strain of Vibrio cholerae MO10 lac -& wild type Transcription level of flrA was observed by Î?"galactosidase assay using flrA promoter-lacZ fusion transcriptional reporter construct — Figure 2. Fig. 2 :Fig. 3 :

Fig. 4 : Comparison of flrC expression among luxS mutant strain of Vibrio cholerae MO10 lac -& wild type. Transcription level of flrC was measured by Î?"galactosidase assay using flrC promoter-lacZ fusion transcriptional reporter construct — Figure 3. Fig. 4 :

Figure 4. Table 2 .

b) Detection of Motility
Motility of the Vibrio cholerae strains were
tested by the method mentioned by Rasid et al. (2003)
using swarm plate containing 0.3 % LB agar.
c) Plasmid construction
The	promoter-lacZ	fusion	containing
transcriptional reporter plasmid of flrA, flrB & flrC were
prepared by PCR amplification of the respective
promoter using primer pairs Promoter A and B for
corresponding gene (Table 1). PCR generated fragment
was digested with EcoRI and BamHI and ligated into the
corresponding sites of plasmid vector pRS551 (Simons
performed using MO10 chromosomal DNA as template

Note: et al.,1987). Then finally electroporated into Vibrio cholerae MO10 lacwild type, Î?"luxS and Î?"flaAluxS strains. All plasmid constructs and strains used in this study were displayed in Table2. All PCRs were

Figure 5. Table 1 :

Target	Primer sequence ( 5'-3')
gene or
encoding
region
FlrA	GC GAATTCGCTCTAGATAGTTTCGCTAA
Promoter-A
FlrA	GCGGATCCGCTCTAGACAAGCGAACCAT
Promoter-B
FlrB	GCGAATTCGCAGATCTTGGGTTGGCTTC
Promoter-A
FlrB	GCGGATCCGCAGATCTCAGCCAGAGCCT
Promoter-B
FlrC	GC GAATTC GCCACTCATAACCCGCTAAA
Promoter-A
FlrC	GCGGATCC CCAGAGTCGTTGCAGCACAA
Promoter-B

Figure 6. Table 2 :

Strains	Description	Source
Vibrio cholerae
strains

Appendix A

Appendix A.1 Acknowledgements

This work was supported by grant SR/SO/HS-43/2006 from Science and Engineering Research Council (SERC), Department of Science and Technology (DST), Government of India. We thank Dr. Sunando Bandyopadhyay for technical help.

Appendix B

, A F González-Barrios , R Zuo , Y Hashimoto , Li Yang , W E Bentley , T K Wood . 2006.
Autoinducer 2 Controls Biofilm Formation in Escherichia coli through a Novel Motility Quorum-Sensing Regulator (MqsR, B3022). Journal of Bacteriology 188 (1) p. .
Vibrio parahaemolyticus FlaJ, a homologue of FliS, is required for production of a flagellin. B J Stewart , L L Mccarter . Molecular Microbiology 1996. 20 p. .
The role of motility as a virulence factor in bacteria. C Josenhans , S Suerbaum . International Journal of Medical Microbiology 2002. 291 p. .
Differential gene expression shows natural brominated furanones interfere with the autoinducer-2 bacterial signaling system of Escherichia coli. D Ren , L Bedzyk , R W Ye , S Thomas , T K Wood . Biotechnology Bioengineering 2004. 88 p. .
FlrA, a ?54 -dependent transcriptional activator in Vibrio fischeri, is required for motility and symbiotic light-organ colonization. D S Millikan , E G Ruby . Journal of Bacteriology 2003. 185 p. .
Vibrio cholerae O1 El Tor: identification of a gene cluster, F H Yildiz , G K Schoolnik . 1999.
DNA Sequence of both chromosomes of the cholera pathogen Vibrio cholerae. J F Heidelberg , J A Eisen , W C Nelson , R A Clayton , M L Gwinn , R J Dodson . Nature 2000. 406 p. .
A short course in bacterial genetics, J H Miller . 1992. New York: Cold Spring Harbor Laboratory Press. (2nd ed))
Chemical and physical properties of cholera exoenterotoxin (choleragen) and its spontaneously formed toxoid (choleragenoid). J J Lospalluto , R A Finkelstein . Biochemica et Biophysica Acta 1972. 257 p. .
Cholera toxin genes: nucleotide sequence, deletion analysis and vaccine development. J J Mekalanos , D J Swartz , G D Pearson , N Harford , F Groyne , M De Wilde . Nature 1983. 306 p. .
Molecular cloning: a laboratory manual, J Sambrook , D W Russel . 2001. New York: Cold Spring Harbor Laboratory Press. (3rd ed))
Differential regulation of multiple flagellins in Vibrio cholerae. K E Klose , J J Mekalanos . Journal of Bacteriology 1998a. 180 p. .
Roles of motility and flagellar structure in pathogenicity of Vibrio cholerae: analysis of motility mutants in three animal models. K Richardson . Infection & Immunity 1991. 59 p. .
The novel sigma54-and sigma28-dependent flagellar gene transcription hierarchy of Vibrio cholerae. M G Prouty , N E Correa , K E Klose . Molecular Microbiology 2001. 39 p. .
Identification of genes involved in the switch between the smooth and rugose phenotypes of Vibrio cholerae. M H Rashid , C Rajanna , A Ali , D K R Karaolis . FEMS Microbiology Letters 2003. 227 p. .
A Novel Regulatory Protein Involved in Motility of Vibrio cholerae. M Moisi , C Jenul , S M Butler , A New , S Tutz , J Reidl , K E Klose , A Camilli , S Schild . Journal of Bacteriology 2009. 191 p. .
Steps in the development of a Vibrio cholerae El Tor biofilm. P I Watnick , R Kolter . Molecular Microbiology 1999. 34 p. .
The absence of a flagellum leads to altered colony morphology, development and virulence in Vibrio cholerae O139. P I Watnick , C M Lauriano , K E Klose , L Croal , R Kolter . Molecular Microbiology 2001. 39 p. .
Use of phoA gene fusions to identify a pilus colonization factor coordinately regulated with cholera toxin, R K Taylor , V L Miller , D B Furlong , J J Mekalanos . 1987. 84 p. . Proceedings of the National Academy of Science of United States of America
Improved single and multicopy lac-based cloning vectors for protein and operon fusions. R W Simons , F Houman , N Kleckner . Gene 1987. 53 p. .
Effects of primer-template mismatches on the polymerase chain reaction: Human Immunodeficiency Virus 1 model studies. S Kwok , D E Kellog , N Mckinney , D Spasic , L Goda , C Levenson , J J Sninsky . Nucleic Acids Research 1990. 18 p. .
Mutation of luxS affects motility and infectivity of Helicobacter pylori in gastric mucosa of a Mongolian gerbil model. T Osaki , T Hanawa , T Manzoku , M Fukuda , H Kawakami , H Suzuki . Journal of Medical Microbiology 2006. 55 p. .
Quorum sensing is a global regulatory mechanism in enterohemorrhagic Escherichia coli O157:H7. V Sperandio , A G Torres , J A Giron , J B Kaper . Journal of Bacteriology 2001. 183 p. .

Global Journal of Medical Research Volume XII Issue V Version I

Table of contents